forward and reverse primers Search Results


86
Sangon Biotech gatccttgatcgtttcggctg sangon biotech n a actin forward
Gatccttgatcgtttcggctg Sangon Biotech N A Actin Forward, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/forward+and+reverse+primers/aagccagcgaggtaggaaggtag+cacttgtgttgctgcctctcctc+forward+primers+reverse+wdr77/pm40449480-254-199-200
Average 86 stars, based on 1 article reviews
gatccttgatcgtttcggctg sangon biotech n a actin forward - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Thermo Fisher forward primer reverse primer probe kcnq1 rs12296050 gtgcttagactgtgcccg gggagaccctgtctcgaa ctcctgggctcctaacctttcacag
Forward Primer Reverse Primer Probe Kcnq1 Rs12296050 Gtgcttagactgtgcccg Gggagaccctgtctcgaa Ctcctgggctcctaacctttcacag, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/forward+and+reverse+primers/Forward+primer+Reverse+primer+Probe+KCNQ1+rs12296050+GTGCTTAGACTGTGCCCG+GGGAGACCCTGTCTCGAA+CTCCTGGGCTCCTAACCTTTCACAG-3'P/10__1161_slash_circgenetics__113__000023-357-51-93
Average 86 stars, based on 1 article reviews
forward primer reverse primer probe kcnq1 rs12296050 gtgcttagactgtgcccg gggagaccctgtctcgaa ctcctgggctcctaacctttcacag - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

90
Seikagaku corporation reverse transcriptase derived from the oligo-dt(12-18) primer and amv (avian myeloblastosis virus)
Reverse Transcriptase Derived From The Oligo Dt(12 18) Primer And Amv (Avian Myeloblastosis Virus), supplied by Seikagaku corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/forward+and+reverse+primers/reverse+transcriptase+derived+from+the+oligo+dt+12+18++primer+and+amv++avian+myeloblastosis+virus+/us07067638-91-9-22
Average 90 stars, based on 1 article reviews
reverse transcriptase derived from the oligo-dt(12-18) primer and amv (avian myeloblastosis virus) - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Promega m-mlv reverse transcriptase, rnase h – point mutant dna polymerase
M Mlv Reverse Transcriptase, Rnase H – Point Mutant Dna Polymerase, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/forward+and+reverse+primers/oligo+dt+primers+and+m+mlv+reverse+transcriptase++rnase+h+minus++point+mutant/pmc00207015-66-36-46
Average 90 stars, based on 1 article reviews
m-mlv reverse transcriptase, rnase h – point mutant dna polymerase - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Promega moloney murine leukemia virus reverse transcriptase primed with oligo(dt) 15 primer
Moloney Murine Leukemia Virus Reverse Transcriptase Primed With Oligo(dt) 15 Primer, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/forward+and+reverse+primers/oligo+dt++primer+and+moloney+murine+leukemia+virus+reverse+transcriptase/pmc04742831-191-17-20
Average 90 stars, based on 1 article reviews
moloney murine leukemia virus reverse transcriptase primed with oligo(dt) 15 primer - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Biolegio bv barcoded forward primer and reverse primer mix biolegio bv
Barcoded Forward Primer And Reverse Primer Mix Biolegio Bv, supplied by Biolegio bv, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/forward+and+reverse+primers/barcoded+forward+primer+and+reverse+primer+mix+biolegio+bv/pmc04717173-144-36-39
Average 90 stars, based on 1 article reviews
barcoded forward primer and reverse primer mix biolegio bv - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Retrogen Inc sequencing primers (forward 5′ aggccgggtgtgtaagcgca 3′; reverse cggaacggacgggactcga 3′)
Sequencing Primers (Forward 5′ Aggccgggtgtgtaagcgca 3′; Reverse Cggaacggacgggactcga 3′), supplied by Retrogen Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/forward+and+reverse+primers/sequencing+primers++forward+5++aggccgggtgtgtaagcgca+3+++reverse+cggaacggacgggactcga+3++/pmc06989188-126-0-18
Average 90 stars, based on 1 article reviews
sequencing primers (forward 5′ aggccgggtgtgtaagcgca 3′; reverse cggaacggacgggactcga 3′) - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Promega puc/m13 forward and reverse primers
Puc/M13 Forward And Reverse Primers, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/forward+and+reverse+primers/forward+and+reverse+primers/10__2503_slash_jjshs__75__249-45-24-26
Average 90 stars, based on 1 article reviews
puc/m13 forward and reverse primers - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Real Time Primers primers for ribosomal protein l13a (rpl13a)
Primers For Ribosomal Protein L13a (Rpl13a), supplied by Real Time Primers, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/forward+and+reverse+primers/and+for+rpl13a+amplification+were++forward++5%E2%80%99+cctggaggagaagaggaaagaga+3%E2%80%99+and++reverse++5%E2%80%99+ttgaggacctctgtgtatttgtcaa+3%E2%80%99/pmc10293174-258-36-50
Average 90 stars, based on 1 article reviews
primers for ribosomal protein l13a (rpl13a) - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Microsynth ag forward (fw3) and reverse primer (rx2)
Forward (Fw3) And Reverse Primer (Rx2), supplied by Microsynth ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/forward+and+reverse+primers/forward+primer++fw3++and+reverse+primer++rx2+/pmc11544705-171-35-42
Average 90 stars, based on 1 article reviews
forward (fw3) and reverse primer (rx2) - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
GeneWorks forward and reverse primers
Forward And Reverse Primers, supplied by GeneWorks, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/forward+and+reverse+primers/forward+and+reverse+primers/pm23820928-66-4-6
Average 90 stars, based on 1 article reviews
forward and reverse primers - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Midland Certified Reagent forward and reverse primers
Forward And Reverse Primers, supplied by Midland Certified Reagent, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/forward+and+reverse+primers/forward+and+reverse+primers/pmc07723275-112-26-29
Average 90 stars, based on 1 article reviews
forward and reverse primers - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

Image Search Results